pcdh18a

Ensembl ID:
ENSDARG00000089805
ZFIN ID:
ZDB-GENE-000607-1
Description:
protocadherin 18a [Source:RefSeq peptide;Acc:NP_001108530]
Human Orthologue:
PCDH18
Human Description:
protocadherin 18 [Source:HGNC Symbol;Acc:14268]
Mouse Orthologue:
Pcdh18
Mouse Description:
protocadherin 18 Gene [Source:MGI Symbol;Acc:MGI:1920423]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10805 Nonsense Available for shipment Available now
sa9402 Nonsense Mutation detected in F1 DNA During 2017
sa32619 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa10805
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127838 Nonsense 229 1123 1 4
Genomic Location (Zv9):
Chromosome 1 (position 12154753)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 12583166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTATGAACTCCAGCTCACAGCCTCAGACAGGGGCGYTCCCCCCAAATTT[G/T]GAAYAACGCTCCTGAAAATCAGCATAGCTGACTCGAACGACAACAATCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127838 Nonsense 392 1123 1 4
Genomic Location (Zv9):
Chromosome 1 (position 12154263)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 12582676
KASP Assay ID:
2259-0310.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAGATACATTCGTGGCTCTGGTGAGTGTAAATGATCTGGACTCTGGCT[T/G]AAATGGAGAGGTGGAGTGCCGTCTCTATGGCCAGGGTCATTKCAGGCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127838 Essential Splice Site 906 1123 4 4
Genomic Location (Zv9):
Chromosome 1 (position 12147180)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 12575593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAAAGAAACTCTAGATTACTAAAAAAAAATCTTTCTTTGCCTTTCAGC[A/T]GTCATGAGATTGTGTACGGAGGAGTGCCGTGTGTTGGGTCACTCTGACCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link