si:ch73-41e3.7

Ensembl ID:
ENSDARG00000089799
ZFIN ID:
ZDB-GENE-090313-163
Description:
hypothetical protein LOC572312 [Source:RefSeq peptide;Acc:NP_001139084]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1980 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1980
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121630 Nonsense 57 302 1 3
ENSDART00000147610 Nonsense 57 302 2 4
Genomic Location (Zv9):
Chromosome 1 (position 397135)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 527259
KASP Assay ID:
554-2752.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCTCTGCAGACGGAGACAGAGCAGCGTAGACTCTGCAGATTMCTGACG[C/T]AGCACGTTTACACACTCCTGCAGCAGAACTTTCAGATGCGTCTGGAGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link