ENSDARG00000089798

Ensembl ID:
ENSDARG00000089798

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21173 Nonsense Mutation detected in F1 DNA During 2014
sa25383 Nonsense Mutation detected in F1 DNA During 2014
sa25382 Nonsense Mutation detected in F1 DNA During 2014
sa25381 Nonsense Mutation detected in F1 DNA During 2014
sa25380 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 82 604 2 2
Genomic Location:
Chromosome 8 (position 1517663)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGATTCCAGCTGTTCTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTTT[T/A]GCATTTAGTACTTGTTTTGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 245 604 2 2
Genomic Location:
Chromosome 8 (position 1517173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGTTGCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTG[G/A]GTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 253 604 2 2
Genomic Location:
Chromosome 8 (position 1517149)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTG[G/A]GTGTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 302 604 2 2
Genomic Location:
Chromosome 8 (position 1517004)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTT[C/T]AGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 408 604 2 2
Genomic Location:
Chromosome 8 (position 1516684)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTTTTG[C/A]TTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/edx33rag