si:dkey-174e3.3

Ensembl ID:
ENSDARG00000089795
ZFIN ID:
ZDB-GENE-090313-199
Human Orthologues:
AL390816.1, SERTAD4
Human Descriptions:
SERTA domain containing 4 [Source:HGNC Symbol;Acc:25236]
UPF0730 protein CS0DE013YM09 [Source:UniProtKB/Swiss-Prot;Acc:Q86TS7]
Mouse Orthologues:
1700086L19Rik, Sertad4
Mouse Descriptions:
RIKEN cDNA 1700086L19 gene Gene [Source:MGI Symbol;Acc:MGI:1921534]
SERTA domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2443496]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42237 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124445 Nonsense 315 338 3 3
ENSDART00000138667   None 137 None 4
Genomic Location (Zv9):
Chromosome 13 (position 32033576)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31679524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAAGAGAGAGAAAAGGGGAAAGAGAGGGTTAAAGGAGGGGAGGTTTCA[C/T]AGCGATGGCTTTCAGACACTATAGGTACTAGACACCATGGAACACTAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link