ENSDARG00000089789

Ensembl ID:
ENSDARG00000089789
Human Orthologues:
SLC12A4, SLC12A5, SLC12A6, SLC12A7
Human Descriptions:
solute carrier family 12 (potassium/chloride transporter), member 5 [Source:HGNC Symbol;Acc:13818]
solute carrier family 12 (potassium/chloride transporters), member 4 [Source:HGNC Symbol;Acc:10913]
solute carrier family 12 (potassium/chloride transporters), member 6 [Source:HGNC Symbol;Acc:10914]
solute carrier family 12 (potassium/chloride transporters), member 7 [Source:HGNC Symbol;Acc:10915]
Mouse Orthologues:
Slc12a4, Slc12a5, Slc12a6, Slc12a7
Mouse Descriptions:
solute carrier family 12, member 4 Gene [Source:MGI Symbol;Acc:MGI:1309465]
solute carrier family 12, member 5 Gene [Source:MGI Symbol;Acc:MGI:1862037]
solute carrier family 12, member 6 Gene [Source:MGI Symbol;Acc:MGI:2135960]
solute carrier family 12, member 7 Gene [Source:MGI Symbol;Acc:MGI:1342283]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34265 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123333 Nonsense 192 255 6 9
Genomic Location (Zv9):
Chromosome 8 (position 46987)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18146
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGTCAGTGACGTCATTTCTTGTGTTCTTTGTTTATAGTCGAATCGT[C/T]AGATCAGACTCAACGAGCTTCTGCAGGAGCACTCCAGCACAGCCAACCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link