
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000089782
- Ensembl ID:
- ENSDARG00000089782
- Human Orthologues:
- FAM111A, FAM111B
- Human Descriptions:
- family with sequence similarity 111, member A [Source:HGNC Symbol;Acc:24725]
- family with sequence similarity 111, member B [Source:HGNC Symbol;Acc:24200]
- Mouse Orthologue:
- Fam111a
- Mouse Description:
- family with sequence similarity 111, member A Gene [Source:MGI Symbol;Acc:MGI:1915508]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40359 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40359
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130294 | Nonsense | 27 | 536 | 1 | 2 |
- Genomic Location (Zv9):
- Chromosome 5 (position 8035378)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 7763683 GRCz11 5 8268321 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCATGCTGTGTCATGTGACACATCCAATACTGTATTCGATGCACTTAATT[C/A]AAACCCTATTTTCAAAAACATTATGATAAAAAACAAAGGTAGAGAAATAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: