ENSDARG00000089776

Ensembl ID:
ENSDARG00000089776
Human Orthologue:
ACTN4
Human Description:
actinin, alpha 4 [Source:HGNC Symbol;Acc:166]
Mouse Orthologue:
Actn4
Mouse Description:
actinin alpha 4 Gene [Source:MGI Symbol;Acc:MGI:1890773]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7772 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128907 Nonsense 4 204 1 6
Genomic Location:
Chromosome 15 (position 41479071)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACWACGCTTTAATAGATGAGATTTTTATTCATTGTCCATGGCTTGGTG[T/A]TTGCAGGAGATTGGCCGGATATCCATTGAGATGAATGGAACTCTAGAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/58j0ofrk