ENSDARG00000089771

Ensembl ID:
ENSDARG00000089771
Human Orthologue:
KCTD5
Human Description:
potassium channel tetramerisation domain containing 5 [Source:HGNC Symbol;Acc:21423]
Mouse Orthologue:
Kctd5
Mouse Description:
potassium channel tetramerisation domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1916509]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24544 Essential Splice Site Available for shipment Available now
sa14096 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130211 Essential Splice Site 92 218 3 9
Genomic Location (Zv9):
Chromosome 24 (position 38803161)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37402740
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTAAACAATGCTTCGAGATTTGAATATATCGTCAATTGTGTGAGGTG[T/A]CAATTTAAGAAACCTGCTGGGTGAACACACTTGTTTATATGATTAGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130211 Essential Splice Site 135 218 6 9
Genomic Location (Zv9):
Chromosome 24 (position 38800000)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37242715
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAACTGAWCAAGGAGAAAATCATCGAAAGRGACGCCAAGAGCACACAC[G/T]TAAGAGAGCGTCAACACAACGCKGGGACCAATATTTTAATRCTACTTAYA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link