ENSDARG00000089771

Ensembl ID:
ENSDARG00000089771
Human Orthologue:
KCTD5
Human Description:
potassium channel tetramerisation domain containing 5 [Source:HGNC Symbol;Acc:21423]
Mouse Orthologue:
Kctd5
Mouse Description:
potassium channel tetramerisation domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1916509]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24544 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14096 Essential Splice Site Available for shipment Available now
sa5084 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130211 Essential Splice Site 92 218 3 9
Genomic Location:
Chromosome 24 (position 38803161)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTTAAACAATGCTTCGAGATTTGAATATATCGTCAATTGTGTGAGGTG[T/A]CAATTTAAGAAACCTGCTGGGTGAACACACTTGTTTATATGATTAGCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130211 Essential Splice Site 135 218 6 9
Genomic Location:
Chromosome 24 (position 38800000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAACTGAWCAAGGAGAAAATCATCGAAAGRGACGCCAAGAGCACACAC[G/T]TAAGAGAGCGTCAACACAACGCKGGGACCAATATTTTAATRCTACTTAYA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130211 Nonsense 192 218 8 9
Genomic Location:
Chromosome 24 (position 38793634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAACTATGGTAATGAGGATCAGGCCGAGTTCCTGTGTGTCGTTTCTAAA[G/T]AGCTGCACAACCAGTCGTACATGAGCAGCTCTCAGCCCAGTGAGAAAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7oje51oz