LOC556026

Ensembl ID:
ENSDARG00000089765
Human Orthologue:
SSX2IP
Human Description:
synovial sarcoma, X breakpoint 2 interacting protein [Source:HGNC Symbol;Acc:16509]
Mouse Orthologue:
Ssx2ip
Mouse Description:
synovial sarcoma, X breakpoint 2 interacting protein Gene [Source:MGI Symbol;Acc:MGI:2139150]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19617 Nonsense Mutation detected in F1 DNA During 2014
sa10423 Nonsense Available for shipment Available now
sa4872 Nonsense F2 line generated During 2014
sa16918 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131015 Nonsense 131 427 5 12
Genomic Location:
Chromosome 1 (position 55797287)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTATCCAAAGCTATAGAGATATTAAACGTGTTGCCGAAGTGGACAGGA[C/T]GAAGAGAGGCTGGATTCAAGACGGCAAAGGCTGATGGGAGGTACATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10423
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131015 Nonsense 222 427 7 12
Genomic Location:
Chromosome 1 (position 55796185)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGAGTCTGGGTGATCATGTGACGGGAGGYGTGGTCCAGGAGTGGATG[C/T]AAGTTCAGAAAACACTGCGGGAKCTCATGGCACAGAGTATAACCTRTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4872
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131015 Nonsense 314 427 9 12
Genomic Location:
Chromosome 1 (position 55794062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTAAGAGGCAGAGGCGGAGCTTCCAGCGGRAGAGGCAGGCCTTCACT[G/T]AGGCTGCCATCCGATTGGGCCGTGAGGTAATTTATGCATGTGCATGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16918
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131015 Essential Splice Site 322 427 9 12
Genomic Location:
Chromosome 1 (position 55794035)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGRAGAGGCAGGCCTTCACTKAGGCTGCCATCCGATTGGGCCGTGAG[G/A]TAATTTATGCATGTGCRTGTTKTTCTATCTTWRATGAAGYAACTGCAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0u29orhu