ENSDARG00000089762

Ensembl ID:
ENSDARG00000089762

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32632 Nonsense Mutation detected in F1 DNA During 2016
sa32631 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39575 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32632
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122532 Nonsense 246 536 1 3
Genomic Location (Zv9):
Chromosome 1 (position 14218694)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14805480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAAACCTCCCACTTCTGATTCATCTGCTGACCCGTGTGATAATGAGGAA[G/T]GACATTGTTGTGAAACATCTGAACAGGCAATTTTAAAATGTATTAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32631
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122532 Essential Splice Site 437 536 1 3
Genomic Location (Zv9):
Chromosome 1 (position 14218117)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14804903
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGTCCCCAAAGCTGATGGTAGCATTGTCAAGCTTCGCACAAGAAAGG[T/A]AAGTAGTTTTAGGTTATTTTTTTTATGAGTAAACAATAGCTGTTTTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39575
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122532 Essential Splice Site 438 536 2 3
Genomic Location (Zv9):
Chromosome 1 (position 14186415)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14773201
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGGTTTTAAGATTAGATTACTTGAATAAAATCTGTTTTTCTCCTTTC[A/T]GAGCTCACATGAAGAGAGGGAGAAGGAGAGGTCCCGGCTGGACTCAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link