ENSDARG00000089734

Ensembl ID:
ENSDARG00000089734
Human Orthologues:
MUC17, MUC5B
Human Descriptions:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16371 Nonsense Available for shipment Available now
sa16169 Nonsense Available for shipment Available now
sa32489 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129696 Nonsense 572 1450 7 8
ENSDART00000129696 Nonsense 572 1450 7 8
Genomic Location:
Chromosome 24 (position 26352863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACACAACTGACATCAGAAACTTCTTCAATGAYTCTTAATACAACAACA[C/T]AATTCACATCAACTACAACTTCTTCAGTGTATCCAAGTACAACAACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129696 Nonsense 572 1450 7 8
ENSDART00000129696 Nonsense 572 1450 7 8
Genomic Location:
Chromosome 24 (position 26352863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACACAACTGACATCAGAAACTTCTTCAATGAYTCTTAATACAACAACA[C/T]AATTCACATCAACTACAACTTCTTCAGTGTATCCAAGTACAACAACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129696 Nonsense 964 1450 8 8
Genomic Location:
Chromosome 24 (position 26355737)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAACACAACTCACATCAACAACTCCAGTAACTCCCAATACAAACACA[C/T]AACTCACGTCAACAACTCCATTGACTCCCAATACAACAACACAACTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link