ENSDARG00000089734

Ensembl ID:
ENSDARG00000089734
Human Orthologues:
MUC17, MUC5B
Human Descriptions:
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16371 Nonsense Available for shipment Available now
sa16169 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129696 Nonsense 572 1450 7 8
ENSDART00000129696 Nonsense 572 1450 7 8
Genomic Location:
Chromosome 24 (position 26352863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACACAACTGACATCAGAAACTTCTTCAATGAYTCTTAATACAACAACA[C/T]AATTCACATCAACTACAACTTCTTCAGTGTATCCAAGTACAACAACACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16169
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129696 Nonsense 572 1450 7 8
ENSDART00000129696 Nonsense 572 1450 7 8
Genomic Location:
Chromosome 24 (position 26352863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAACACAACTGACATCAGAAACTTCTTCAATGAYTCTTAATACAACAACA[C/T]AATTCACATCAACTACAACTTCTTCAGTGTATCCAAGTACAACAACACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0cbloy70