ENSDARG00000089724

Ensembl ID:
ENSDARG00000089724
Human Orthologue:
CYLD
Human Description:
cylindromatosis (turban tumor syndrome) [Source:HGNC Symbol;Acc:2584]
Mouse Orthologue:
Cyld
Mouse Description:
cylindromatosis (turban tumor syndrome) Gene [Source:MGI Symbol;Acc:MGI:1921506]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16979 Nonsense Available for shipment Available now
sa41840 Nonsense Mutation detected in F1 DNA During 2016
sa41841 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16979
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126211 Nonsense 455 594 11 13
Genomic Location (Zv9):
Chromosome 11 (position 26220739)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25049564
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTRAATATGAATGTGTGCAATGCCTGAYGGACCGCAAGCTTCAGCCAGGC[A/T]AAATTAAGCWGTWTTGCTCCACCTGCAACACACAGGTAGTRCAYCTGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126211 Nonsense 587 594 13 13
Genomic Location (Zv9):
Chromosome 11 (position 26224858)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25053683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTGAGGCGGTGCGCCGACTGATGGTTGATTCATACATGTGTCTTTA[T/G]CAGACAACAGACTGTCAACAATAATCACACACACACACACTTACACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126211 Nonsense 593 594 13 13
Genomic Location (Zv9):
Chromosome 11 (position 26224874)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 25053699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGACTGATGGTTGATTCATACATGTGTCTTTATCAGACAACAGACTGT[C/T]AACAATAATCACACACACACACACTTACACACACACACACACATTTCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Crohn's disease: A genome-wide scan of Ashkenazi Jewish Crohn's disease suggests novel susceptibility loci. (View Study)
  • Leprosy: Identification of two new loci at IL23R and RAB32 that influence susceptibility to leprosy. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link