NR_027750.1

Ensembl ID:
ENSDARG00000089722
Description:
wu:fb63d09 (wu:fb63d09), non-coding RNA [Source:RefSeq DNA;Acc:NR_027750]
Human Orthologue:
C1S
Human Description:
complement component 1, s subcomponent [Source:HGNC Symbol;Acc:1247]
Mouse Orthologues:
C1s, Gm5077
Mouse Descriptions:
complement component 1, s subcomponent Gene [Source:MGI Symbol;Acc:MGI:1355312]
predicted gene 5077 Gene [Source:MGI Symbol;Acc:MGI:3644269]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36186 Nonsense Mutation detected in F1 DNA During 2017
sa28692 Essential Splice Site Mutation detected in F1 DNA During 2017
sa17835 Nonsense Available for shipment Available now
sa42761 Essential Splice Site Mutation detected in F1 DNA During 2017
sa10018 Nonsense Available for shipment Available now
sa36185 Nonsense Available for shipment Available now
sa39111 Nonsense Mutation detected in F1 DNA During 2017
sa18410 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122049 Nonsense 43 673 2 11
Genomic Location (Zv9):
Chromosome 16 (position 34192333)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31730303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACATCCACTAGGTTATGAACCTTATTCCAATATGACTTGGAAAGAGTG[T/A]GCTCCGGCTGGACACAGAATCACACTCACTCTCACACATGTAGACCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28692
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122049 Essential Splice Site 237 673 5 11
Genomic Location (Zv9):
Chromosome 16 (position 34184631)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31722601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGACGTGGAAAAGGCAGACAATGGACGGTGCATTGACTCATTAACCG[T/A]AGGTAACATGTAAAGTCTTGTCTCTTTCTCTTTGTATTTCGCCTCAATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17835
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122049 Nonsense 283 673 6 11
Genomic Location (Zv9):
Chromosome 16 (position 34184410)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31722380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTTAGGACWRACCATAAAGGAACAAACCGAGGGTTTCGCCTTAGWTA[T/G]AAAACTAAAGGTTTGTYTTTCCTATCATTAAAASTAAASACTTCATATRC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42761
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122049 Essential Splice Site 394 673 9 11
Genomic Location (Zv9):
Chromosome 16 (position 34183274)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31721244
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAATCAGTCTCAAGTGCAAATCTAAATTTTATCAACTGGATACAAATGG[T/G]GAGACTTGTATGGTTTATGTGAATTACAGTAATTCTAAACAAACAAATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10018
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122049 Nonsense 445 673 11 11
Genomic Location (Zv9):
Chromosome 16 (position 34182908)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31720878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGACTCTTTTGGTGGAAGAGTCTTTGGCGGGAAGCRAGCACAACCAGGA[C/T]ARATTCCATGGCAGCTCTTACATAAGTTCAACCCTAGAGGTGGTGCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36185
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122049 Nonsense 481 673 11 11
Genomic Location (Zv9):
Chromosome 16 (position 34182800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31720770
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGATTACTGGGCTCTGACAGCTGCTCATGTAGTGGATGGATATGAAAGC[A/T]AAACCATGAGTTGGTTAGGGGGAATAACTGATGGTCTGGACGAAAAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39111
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122049 Nonsense 497 673 11 11
Genomic Location (Zv9):
Chromosome 16 (position 34182752)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31720722
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAAAACCATGAGTTGGTTAGGGGGAATAACTGATGGTCTGGACGAAAAA[C/T]AAGTCGCTATGGTGACTGAAAAAATAATCATTCATCCAAAATATAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122049 Nonsense 511 673 11 11
Genomic Location (Zv9):
Chromosome 16 (position 34182708)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31720678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RAAAAACAAGTCGCTATRGTGACTGAAAAAATAATCATTCATCCAAAATA[T/G]AATAAAGTTGGGCTTGAATTGGGAAAMAAMCAAACAAACTTTGATAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link