LOC100332786

Ensembl ID:
ENSDARG00000089710
Human Orthologue:
CD22
Human Description:
CD22 molecule [Source:HGNC Symbol;Acc:1643]
Mouse Orthologue:
Cd22
Mouse Description:
CD22 antigen Gene [Source:MGI Symbol;Acc:MGI:88322]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12756 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127878 Essential Splice Site 140 392 2 8
Genomic Location:
Chromosome 1 (position 57986329)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAATGGCAAATGGATTGGTAAAATTGGAGTGYGTCTCTCTGTCACAG[G/T]TGACTYTCCTGAGGTTTCTCTCTTCTTGTGRTCATWATGTAGAATAATAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cvf72la2