GFRAL

Ensembl ID:
ENSDARG00000089709
Description:
GDNF family receptor alpha like [Source:HGNC Symbol;Acc:32789]
Human Orthologue:
GFRAL
Human Description:
GDNF family receptor alpha like [Source:HGNC Symbol;Acc:32789]
Mouse Orthologue:
Gfral
Mouse Description:
GDNF family receptor alpha like Gene [Source:MGI Symbol;Acc:MGI:3607786]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16098 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16098
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124134 Essential Splice Site 327 382 7 8
Genomic Location:
Chromosome 13 (position 1771677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGTGTTTTGTCATCTGCTGTAATTAAACAAATTATCGTTTTTATCCC[A/T]GATCAGCTGCTGTACCTCYTGATATACATCTCTGCATTRATGGTGCTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c8u50n2k