LOC100005485

Ensembl ID:
ENSDARG00000089698
Human Orthologue:
ATF7IP2
Human Description:
activating transcription factor 7 interacting protein 2 [Source:HGNC Symbol;Acc:20397]
Mouse Orthologue:
Atf7ip2
Mouse Description:
activating transcription factor 7 interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1922579]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31332 Missense Available for shipment Available now
sa33181 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31332
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122841 Missense 17 369 1 11
Genomic Location (Zv9):
Chromosome 3 (position 27216545)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26934584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGAAAAGGAGCAGATATGAAGATGATTCTGGAACGTTACAGTTGGCTC[C/T]AGGCAGTGGCCAGAAAGCGAGCAAGCTCCCCCGATCCGAGGCAAGTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122841 Nonsense 103 369 3 11
Genomic Location (Zv9):
Chromosome 3 (position 27212876)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 26930915
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTATTTGCATATATCAGAAAATGCAGGTCTCTGGGGATTTCTCATAGT[C/T]AGGTATGAACTGAGATTTTATTGTTAAAAAGCTGAATTGCATTTTTGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link