ISM2 (1 of 2)

Ensembl ID:
ENSDARG00000089691
Description:
isthmin 2 homolog (zebrafish) [Source:HGNC Symbol;Acc:23176]
Human Orthologue:
ISM2
Human Description:
isthmin 2 homolog (zebrafish) [Source:HGNC Symbol;Acc:23176]
Mouse Orthologue:
Ism2
Mouse Description:
isthmin 2 homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:2685110]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11117 Nonsense Available for shipment Available now
sa23037 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11117
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123311 Nonsense 149 460 3 6
Genomic Location:
Chromosome 17 (position 17712760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAGATGGAGATTGAGATGGATCTGGCCAAGGAGAGCAGGAACGACTG[G/A]TCCTTGAGCTCGGAGGAATGGCTAGGCCATAAAAAGCTCTTCTGGCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23037
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123311 Nonsense 164 460 3 6
Genomic Location:
Chromosome 17 (position 17712805)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACTGGTCCTTGAGCTCGGAGGAATGGCTAGGCCATAAAAAGCTCTTCTG[G/A]CCACTGTTTTGGGAATACCACGACTCCAGTCAGGAAGGTCCCGGGCAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2u6ic7so