ENSDARG00000089690

Ensembl ID:
ENSDARG00000089690
Human Orthologues:
POMZP3, ZP3
Human Descriptions:
POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
Mouse Orthologue:
Zp3
Mouse Description:
zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14452 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130372 Essential Splice Site 64 115 2 4
Genomic Location:
Chromosome 15 (position 42568336)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGAGCTGAGCCGCAGCGCCACCGTCCAGCCGGTCATCAGCAACAGCGG[G/A]TCAGTCAGTGWGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tyx7x0qq