ENSDARG00000089685

Ensembl ID:
ENSDARG00000089685
Human Orthologue:
ANKFN1
Human Description:
ankyrin-repeat and fibronectin type III domain containing 1 [Source:HGNC Symbol;Acc:26766]
Mouse Orthologue:
Ankfn1
Mouse Description:
ankyrin-repeat and fibronectin type III domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:2686021]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7314 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128121 Essential Splice Site 80 502 2 9
Genomic Location:
Chromosome 3 (position 1063615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGAGCTGCTCCACATCCATCACRCAGGACCTGCTGTGGCTCGCCAAGG[T/G]CTGAAACACACACGTCAGGAGGAYGCGTCTCAGTCTAACAGCACTGCTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e6z1u7j1