ENSDARG00000089680

Ensembl ID:
ENSDARG00000089680
Human Orthologue:
MRPL39
Human Description:
mitochondrial ribosomal protein L39 [Source:HGNC Symbol;Acc:14027]
Mouse Orthologue:
Mrpl39
Mouse Description:
mitochondrial ribosomal protein L39 Gene [Source:MGI Symbol;Acc:MGI:1351620]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17569 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17569
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130552 Nonsense 58 246 1 6
Genomic Location:
Chromosome 16 (position 1215357)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGCTGACGGCAGAACAGTGAAGGGGTCAGCAGGAGTGACATCACCGCTA[C/T]AGATCGMCCGCAGTGAACGGTGAATAYAACACACACACNNNNNNACACANNNNNNNNNNG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9px292o1