TTLL5

Ensembl ID:
ENSDARG00000089650
Description:
tubulin tyrosine ligase-like family, member 5 [Source:HGNC Symbol;Acc:19963]
Human Orthologue:
TTLL5
Human Description:
tubulin tyrosine ligase-like family, member 5 [Source:HGNC Symbol;Acc:19963]
Mouse Orthologue:
Ttll5
Mouse Description:
tubulin tyrosine ligase-like family, member 5 Gene [Source:MGI Symbol;Acc:MGI:2443657]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13692 Nonsense Available for shipment Available now
sa7845 Nonsense Mutation detected in F1 DNA During 2014
sa12240 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13692
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103339 Nonsense 22 343 2 11
Genomic Location:
Chromosome 17 (position 52468910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTGGTACCACARAAGAATTATCCGTACACKCTTTGTCYRACAGGAAA[C/T]AGCCGTGTATCGCCTGGAGTGGTGTCAGTAAACGCATTCCTGTGCTGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103339 Nonsense 248 343 9 11
ENSDART00000103339 Nonsense 248 343 9 11
Genomic Location:
Chromosome 17 (position 52481747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTTTTCCTGCTCGGTTGTGYGTGTTGTAGGTTTGCCACRGTGAAGTA[T/A]GACCACGCCACTGCAAACATCAAGAACCAGTTCATGCATCTGACCAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103339 Nonsense 248 343 9 11
ENSDART00000103339 Nonsense 248 343 9 11
Genomic Location:
Chromosome 17 (position 52481747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTTTTCCTGCTCGGTTGTGYGTGTTGTAGGTTTGCCACRGTGAAGTA[T/A]GACCACGCCACTGCAAACATCAAGAACCAGTTCATGCATCTGACCAACTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xuy76n7o