LOC571337

Ensembl ID:
ENSDARG00000089646
Human Orthologue:
CTDSPL2
Human Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 [Source:HGN
Mouse Orthologue:
Ctdspl2
Mouse Description:
CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 Gene [Sourc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41772 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126084 Nonsense 196 360 6 11
Genomic Location (Zv9):
Chromosome 11 (position 5862440)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 5830623
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTTATTTGTACATTTTTCTATCTTAGGATGAAACCCTGGTGTTCAGTT[C/A]ACTCAATGTGATCCCTGATGCAGAATACACCTTCAATACACGCTTTCAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link