si:dkey-117n7.5

Ensembl ID:
ENSDARG00000089640
ZFIN ID:
ZDB-GENE-060503-331
Description:
hypothetical protein LOC559444 [Source:RefSeq peptide;Acc:NP_001038359]
Human Orthologue:
SPINT3
Human Description:
serine peptidase inhibitor, Kunitz type, 3 [Source:HGNC Symbol;Acc:11248]
Mouse Orthologue:
Spint3
Mouse Description:
serine peptidase inhibitor, Kunitz type, 3 Gene [Source:MGI Symbol;Acc:MGI:3651470]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa781 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101575 Nonsense 168 172 3 4
Genomic Location (Zv9):
Chromosome 4 (position 15039668)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 15975521
KASP Assay ID:
554-0686.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCGATTCAGCTCCAAACAGGACTGCCAGAGTACATGCATTCTGGGAAGG[A/T]GAGGTAAAGAGCCAATCAGAATTCAGACTTCAGGTTTTAAAATAAATGAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link