si:ch211-160d20.5

Ensembl ID:
ENSDARG00000089627
ZFIN ID:
ZDB-GENE-050420-242
Description:
Novel protein kinase domain containing protein [Source:UniProtKB/TrEMBL;Acc:Q1LXY0]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36696 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36696
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101483 Nonsense 206 287 4 6
ENSDART00000141694 Nonsense 604 693 7 9
Genomic Location (Zv9):
Chromosome 18 (position 35245206)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 36924362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACACCATGCTGACCCAGTAAACGTCTGGACAATTGGCGTCGTGCTGTA[T/A]GAAATCTTGCATGCAGATTTGCCCTTTACCGACGAACATTCAATAATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link