FAT3 (3 of 4)

Ensembl ID:
ENSDARG00000089615
Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Human Orthologue:
FAT3
Human Description:
FAT tumor suppressor homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:23112]
Mouse Orthologue:
Fat3
Mouse Description:
FAT tumor suppressor homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2444314]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21736 Nonsense Available for shipment Available now
sa13091 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126796 Nonsense 319 514 1 1
Genomic Location (Zv9):
Chromosome 10 (position 25828486)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25232444
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATTGCAGGTGATCCTCAGGAGCAGTTTGTCCTTGACAGAGCTCCACTT[G/T]GAAATGAGTACAAGCTAAAGATGTCTGAGCCTGTCAACTGGGATAAATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13091
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126796 Nonsense 407 514 1 1
Genomic Location (Zv9):
Chromosome 10 (position 25828220)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 25232178
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATTGTAGAAACTGTGAGGATATCCCCAAGACCGCCGGTTGTCAGCTA[T/A]GCCCTWAGTCTGACMTCTGATTCAATATTTTTTATAATTAATCCACTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link