pbx1a

Ensembl ID:
ENSDARG00000089610
ZFIN ID:
ZDB-GENE-000405-1
Description:
pre-B-cell leukemia transcription factor 1a (pbx1a), transcript variant 1, mRNA [Source:RefSeq DNA;A
Human Orthologue:
PBX1
Human Description:
pre-B-cell leukemia homeobox 1 [Source:HGNC Symbol;Acc:8632]
Mouse Orthologue:
Pbx1
Mouse Description:
pre B-cell leukemia transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:97495]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12947 Essential Splice Site Available for shipment Available now
sa15504 Nonsense Available for shipment Available now
sa17065 Essential Splice Site Available for shipment Available now
sa6831 Missense, Nonsense Mutation detected in F1 DNA During 2017
sa32888 Missense, Nonsense Mutation detected in F1 DNA During 2017
sa31272 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750   48 260 1 5
ENSDART00000038419 Essential Splice Site 39 337 2 9
ENSDART00000073947   48 342 1 7
Genomic Location (Zv9):
Chromosome 2 (position 19717702)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19085713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGYCCTGAGAAAGGGGGCGGGTCTGCTGCTGCTGCAGCTGCTGCTGCTGC[G/A]GCAGGCGGYGTCGGCTCCGATAACTCCGCCGAACACTCAGACTACAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15504
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 Nonsense 209 260 4 5
ENSDART00000038419 Nonsense 200 337 6 9
ENSDART00000073947 Nonsense 209 342 4 7
Genomic Location (Zv9):
Chromosome 2 (position 19729939)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19073476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGTATCCAAYTGGTTTGGAAACAAAAGGATCAGATACAAGAAAAATATT[G/T]GAAAATTCCAAGAAGAAGCCAACATGTACGCTGCCRGAACCGCCGCTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17065
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 Essential Splice Site 246 260 None 5
ENSDART00000038419 Essential Splice Site 275 337 None 9
ENSDART00000073947 Essential Splice Site 283 342 None 7
Genomic Location (Zv9):
Chromosome 2 (position 19738109)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19065306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGACRTCTTTGTTTTGAACGCTTTTGTGTGTTGTGTTCCGGTGTCTGC[A/T]GGTGGATACTCTTCGCCATGTTAWCAGTCAGACAGGAGGATACAGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6831
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 Nonsense 253 260 5 5
ENSDART00000038419 Missense 282 337 8 9
ENSDART00000073947 Missense 290 342 6 7
Genomic Location (Zv9):
Chromosome 2 (position 19738133)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19065282
KASP Assay ID:
554-5116.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGTGTTGTGTTCCGGTGTCTGCAGGTGGATACTCTTCGCCATGTTA[T/A]CAGTCAGACAGGAGGATACAGTGAAAGCCTYGCTGCCAGTCAGATATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32888
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 Nonsense 255 260 5 5
ENSDART00000038419 Missense 284 337 8 9
ENSDART00000073947 Missense 292 342 6 7
Genomic Location (Zv9):
Chromosome 2 (position 19738138)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19065277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTGTGTTCCGGTGTCTGCAGGTGGATACTCTTCGCCATGTTATCAGT[C/A]AGACAGGAGGATACAGTGAAAGCCTTGCTGCCAGTCAGATATACAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750   None 260 None 5
ENSDART00000038419 Essential Splice Site 304 337 8 9
ENSDART00000073947 Essential Splice Site 312 342 6 7
Genomic Location (Zv9):
Chromosome 2 (position 19738202)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19065213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGAAAGCCTTGCTGCCAGTCAGATATACAGTCCACAGGGCATCAATG[T/C]AAGTCCGCACTCTCTGTTTTTCAAGCTTGTACCTGATTCTGCTGTTGTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer (prognosis): Identification of inherited genetic variations influencing prognosis in early-onset breast cancer. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link