si:dkey-217f16.1

Ensembl ID:
ENSDARG00000089602
ZFIN ID:
ZDB-GENE-091116-95
Mouse Orthologues:
Gm4070, Gvin1
Mouse Descriptions:
GTPase, very large interferon inducible 1 Gene [Source:MGI Symbol;Acc:MGI:1921808]
predicted gene 4070 Gene [Source:MGI Symbol;Acc:MGI:3782245]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11889 Essential Splice Site Available for shipment Available now
sa39974 Nonsense Mutation detected in F1 DNA During 2017
sa7315 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa11889
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099242   None 1834 None 2
ENSDART00000143111 Essential Splice Site 123 595 2 4
Genomic Location (Zv9):
Chromosome 3 (position 4259527)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4039186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TYTGTRTATKTGMTTTAWTAGTTTAAAACTRGTGCATTTCCTYTTTTACA[G/T]GTTYAACTGAGWGTGAAGATGAACTGAGGATTGTTCTTCTGGGAAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099242 Nonsense 1515 1834 2 2
ENSDART00000143111   None 595 None 4
Genomic Location (Zv9):
Chromosome 3 (position 4253049)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4032708
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATAAATTGAAGGAACCCATTGAGCAGAGCGTCTACAAGAAAACTGCC[A/T]GAGATTTAGCAGATGAAATGAAAACAGACTGTGCATCACTGAGTGGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099242 Nonsense 1803 1834 2 2
ENSDART00000143111   None 595 None 4
Genomic Location (Zv9):
Chromosome 3 (position 4252183)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 4031842
KASP Assay ID:
554-4474.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTACTGGAARTGGTTTGTGTGCMGATTCCAGARAGATYTGGAAAAAYA[C/G]TACAGTARAACATTTGAGGGAAGTGGTGAGATACCAGATGARTGGAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link