plce1

Ensembl ID:
ENSDARG00000089601
ZFIN ID:
ZDB-GENE-061212-4
Description:
1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase epsilon-1 [Source:RefSeq peptide;Acc:NP_0
Human Orthologue:
PLCE1
Human Description:
phospholipase C, epsilon 1 [Source:HGNC Symbol;Acc:17175]
Mouse Orthologue:
Plce1
Mouse Description:
phospholipase C, epsilon 1 Gene [Source:MGI Symbol;Acc:MGI:1921305]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22015 Nonsense Available for shipment Available now
sa14377 Essential Splice Site Available for shipment Available now
sa41951 Essential Splice Site Mutation detected in F1 DNA During 2017
sa27871 Nonsense Mutation detected in F1 DNA During 2017
sa41950 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa22015
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Nonsense 56 1193 1 12
Genomic Location (Zv9):
Chromosome 12 (position 5606183)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5216855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGCTCGTTTATTAATGAACTACAGTTTGCCTGGGGGCACACCCCCT[C/T]AGACACCAGTACATTTGGAGGGGGACTCAGTGGGCACAGTGTGCAGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Essential Splice Site 446 1193 2 12
Genomic Location (Zv9):
Chromosome 12 (position 5550197)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5272841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCYCTGCCCRGCTTCACTGTTGGCTCCACAGGACGAGCAATGCTGAAAG[G/A]TAAAGAAATGTACYACTTTTCTGTCTAAMTGCTGCTTTAAAATTKAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Essential Splice Site 687 1193 5 12
Genomic Location (Zv9):
Chromosome 12 (position 5512741)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5310297
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTATTGGACTGCGTCCGTCTTTTGATTCTCAAGAAGATCCTGTTGAGG[T/C]GAGGCACTTCTATGAAGTGATTATGGCTAATGCAGGAAATTATATCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27871
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Nonsense 764 1193 7 12
Genomic Location (Zv9):
Chromosome 12 (position 5508748)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5314290
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTACCTTCTATCCTTAATGTCCACTCTGAAGGAAAGGACCTGGGACTGAA[C/T]GAGTCCTGTAAGTTGCCAGAAAGATCTGTTTTAAAGCACTTAATGGATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Essential Splice Site 1052 1193 9 12
Genomic Location (Zv9):
Chromosome 12 (position 5500685)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5322353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTGGGCATCAACTCCAATGTCAAAAAAAAGAAAAAGGCCTTAGTCAGG[G/A]TGAGTAGAGAAGCACCGCGAGGCAACAGTGTGTTTTTTTTTTTTCTCGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link