ENSDARG00000089599

Ensembl ID:
ENSDARG00000089599
Human Orthologue:
CUZD1
Human Description:
CUB and zona pellucida-like domains 1 [Source:HGNC Symbol;Acc:17937]
Mouse Orthologues:
Cuzd1, Dmbt1
Mouse Descriptions:
CUB and zona pellucida-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:1202881]
deleted in malignant brain tumors 1 Gene [Source:MGI Symbol;Acc:MGI:106210]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43026 Nonsense Mutation detected in F1 DNA During 2016
sa4734 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23207 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa43026
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128412 Nonsense 116 586 2 10
Genomic Location:
Chromosome 18 (position 4356868)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACACAAACAACCCCTACAGCAGCACCTATAATGACTACAACTACCT[T/A]GGCAACATCCAAAGCATCAACTACTTTACCACTGAGCAAAATTCCTCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128412 Essential Splice Site 185 586 4 10
Genomic Location:
Chromosome 18 (position 4357366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGTTATTTGTCTCTCGGTTTTATATCTTGTTGTTGYTTTCGTCATCC[A/T]GAATTATTGATGTCATCATTAGTGGACCATTAAACAGCACAAAGACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128412 Nonsense 579 586 10 10
Genomic Location:
Chromosome 18 (position 4360999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTTGCGGTGTGATCTTCTACACATCCAGGACACCCGGGATCAGAAAA[C/T]AACCCTTGTCATCACACGACTTTTAAACGTGTCAGCGTTTTTTTTCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link