ENSDARG00000089599

Ensembl ID:
ENSDARG00000089599
Human Orthologue:
CUZD1
Human Description:
CUB and zona pellucida-like domains 1 [Source:HGNC Symbol;Acc:17937]
Mouse Orthologues:
Cuzd1, Dmbt1
Mouse Descriptions:
CUB and zona pellucida-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:1202881]
deleted in malignant brain tumors 1 Gene [Source:MGI Symbol;Acc:MGI:106210]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4734 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23207 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128412 Essential Splice Site 185 586 4 10
Genomic Location:
Chromosome 18 (position 4357366)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATGTTATTTGTCTCTCGGTTTTATATCTTGTTGTTGYTTTCGTCATCC[A/T]GAATTATTGATGTCATCATTAGTGGACCATTAAACAGCACAAAGACCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23207
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128412 Nonsense 579 586 10 10
Genomic Location:
Chromosome 18 (position 4360999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTTGCGGTGTGATCTTCTACACATCCAGGACACCCGGGATCAGAAAA[C/T]AACCCTTGTCATCACACGACTTTTAAACGTGTCAGCGTTTTTTTTCCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2xuaoi2l