ENSDARG00000089586

Ensembl ID:
ENSDARG00000089586
Human Orthologues:
NCAM1, NCAM2
Human Descriptions:
neural cell adhesion molecule 1 [Source:HGNC Symbol;Acc:7656]
neural cell adhesion molecule 2 [Source:HGNC Symbol;Acc:7657]
Mouse Orthologues:
Ncam1, Ncam2
Mouse Descriptions:
neural cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:97281]
neural cell adhesion molecule 2 Gene [Source:MGI Symbol;Acc:MGI:97282]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36249 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123960 Nonsense 626 763 16 18
Genomic Location (Zv9):
Chromosome 16 (position 47762830)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 44961026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGAGTGAAAAAAAGTTGGAGAAGAACTCCGTCTCCATCCCTATCAAA[C/T]AGCTGAAAGATGGAGGCTCTCCCATTCTACAATACATTGTTCGCTACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Left ventricular mass: Genetic variation in NCAM1 contributes to left ventricular wall thickness in hypertensive families. (View Study)
  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)
  • Obesity: A genome-wide association study on obesity and obesity-related traits. (View Study)
  • Total ventricular volume: Genome-wide association with MRI atrophy measures as a quantitative trait locus for Alzheimer's disease. (View Study)
  • Visceral fat: Genome-wide association for abdominal subcutaneous and visceral adipose reveals a novel locus for visceral fat in women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link