ENSDARG00000089577

Ensembl ID:
ENSDARG00000089577

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38183 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24799 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127315 Essential Splice Site 152 375 3 5
Genomic Location:
Chromosome Zv9_NA331 (position 106144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTTAGTGCCTAACAGATCCCCAATCTCTACCACTCTACCACTTCTTAG[G/A]TAAAAACTGCATTCTAGATGTGCATTCAACATGATGTAGGAATATAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127315 Essential Splice Site 152 375 4 5
Genomic Location:
Chromosome Zv9_NA331 (position 106226)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGTAGGAATATAAATGTACATGACATTGGCACTTTGTTTGTGTTGCA[G/A]AGTTCCTCAAAACTGTGCCAGGAGGTACAACCTTTTAGCCTTTGATCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link