NP_001154179.1

Ensembl ID:
ENSDARG00000089572
Description:
TCF3 fusion partner homolog [Source:RefSeq peptide;Acc:NP_001154179]
Human Orthologue:
TFPT
Human Description:
TCF3 (E2A) fusion partner (in childhood Leukemia) [Source:HGNC Symbol;Acc:13630]
Mouse Orthologue:
Tfpt
Mouse Description:
TCF3 (E2A) fusion partner Gene [Source:MGI Symbol;Acc:MGI:1916964]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17486 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122861 Essential Splice Site 162 186 4 5
ENSDART00000126425 Essential Splice Site 170 194 5 6
Genomic Location (Zv9):
Chromosome 16 (position 5482599)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4709152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGYAAAGAGAAAGAGACACCGGCTCCARAARGACAGAGACACGCAG[G/A]TACATAAATAAAGACTATTAAAGATTTTACWGCTCCTGAACTCTCCAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link