LOC556271

Ensembl ID:
ENSDARG00000089567
Human Orthologue:
PATL2
Human Description:
protein associated with topoisomerase II homolog 2 (yeast) [Source:HGNC Symbol;Acc:33630]
Mouse Orthologue:
Patl2
Mouse Description:
protein associated with topoisomerase II homolog 2 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1914828]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8546 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa5851 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124799 Splice Site, Nonsense 347 714 9 19
Genomic Location:
Chromosome 12 (position 14203786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCACCCCCAGCATAAGCGGCTTTTGAGTCAGCGACAGCCAAGACCACAT[A/T]AGTGAGAAGTGAGAAATGTATTTACTNNTAAAGTATGTTTGCCCCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5851
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124799 Nonsense 631 714 17 19
Genomic Location:
Chromosome 12 (position 14208631)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTTTTTTAACAAAACCTTGTGTTTGCAGTTTGGTCTGTCGTTGCTGTA[T/A]GCTCTACTCTCACAGGGAGAAAGGCTTTTATCTTCTGATCTACCCATGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4ut7bg97