MDFI

Ensembl ID:
ENSDARG00000089564
Description:
MyoD family inhibitor [Source:HGNC Symbol;Acc:6967]
Human Orthologue:
MDFI
Human Description:
MyoD family inhibitor [Source:HGNC Symbol;Acc:6967]
Mouse Orthologues:
Gm765, Mdfi
Mouse Descriptions:
MyoD family inhibitor Gene [Source:MGI Symbol;Acc:MGI:107687]
predicted gene 765 Gene [Source:MGI Symbol;Acc:MGI:2685611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41820 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41820
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122136 Essential Splice Site 33 252 2 4
Genomic Location (Zv9):
Chromosome 11 (position 22968510)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 21974741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAACTTGTATTTTCTTTCTCTCTCCTGCGTGTTTGTGTTTTTTGGCCTC[A/T]GAAGGGAATGAAACCGGTGAGCAGACAGCACAGAACTCAAACACCCCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link