LOC564748

Ensembl ID:
ENSDARG00000089543
Human Orthologues:
LRRN4, LRRN4CL
Human Descriptions:
leucine rich repeat neuronal 4 [Source:HGNC Symbol;Acc:16208]
LRRN4 C-terminal like [Source:HGNC Symbol;Acc:33724]
Mouse Orthologues:
Lrrn4, Lrrn4cl
Mouse Descriptions:
leucine rich repeat neuronal 4 Gene [Source:MGI Symbol;Acc:MGI:2445154]
LRRN4 C-terminal like Gene [Source:MGI Symbol;Acc:MGI:1916102]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38491 Nonsense Mutation detected in F1 DNA During 2017
sa26528 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38491
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122768 Nonsense 68 224 1 1
Genomic Location (Zv9):
Chromosome 5 (position 39094965)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36894649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCCAGCTCATCCTCCACCAGCGCTCTGGATCTCAACCCGTGTGACTA[C/A]GACATGTGTGTGGAGCAGCAGCAAACCTGCATGGATCTTGCAAAGGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122768 Nonsense 75 224 1 1
Genomic Location (Zv9):
Chromosome 5 (position 39094984)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 36894668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCGCTCTGGATCTCAACCCGTGTGACTACGACATGTGTGTGGAGCAG[C/T]AGCAAACCTGCATGGATCTTGCAAAGGTGGAAAACTGCCTCTGCCCGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link