UBR3 (1 of 2)

Ensembl ID:
ENSDARG00000089532
Description:
ubiquitin protein ligase E3 component n-recognin 3 (putative) [Source:HGNC Symbol;Acc:30467]
Human Orthologue:
UBR3
Human Description:
ubiquitin protein ligase E3 component n-recognin 3 (putative) [Source:HGNC Symbol;Acc:30467]
Mouse Orthologue:
Ubr3
Mouse Description:
ubiquitin protein ligase E3 component n-recognin 3 Gene [Source:MGI Symbol;Acc:MGI:1861100]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16777 Nonsense Available for shipment Available now
sa31698 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41342 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41341 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123038 Nonsense 79 347 2 8
Genomic Location:
Chromosome 9 (position 4019469)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATGTCTGAAATGGTGCTGCCGCGGTTTATCATCACTATCATTCAATA[T/G]CTGAGAGACGGCTACACTGAACCAGGTGAGGACACCAGGGGCTTTATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123038 Essential Splice Site 142 347 3 8
Genomic Location:
Chromosome 9 (position 4017787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCACCAAGATCTTAACCGATCAGCAGACCTTTAAAGAGCTCAGCATGG[G/A]TATGTATGGGATGTGTTGGCATTGCAACATTTATTTATATTTATATTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41342
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123038 Essential Splice Site 226 347 7 8
Genomic Location:
Chromosome 9 (position 4014082)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTTTATATCTAAAATTTCTTGGTTTTCTTGCTGTTTCTGTTTCGAT[A/T]GATCCATCCATAATGGACACGCTGAAACATAAATGCTTTTTAGAAGAGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41341
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123038 Nonsense 253 347 7 8
Genomic Location:
Chromosome 9 (position 4014000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCTTTTTAGAAGAGTTACTGTTTTGGACTATTAAGTATGAATTTCCA[C/T]AGAAGATGGTGACGTTTTTGCTCAACATGTTGCCAGATCAGGATTACAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link