UBR3 (1 of 2)

Ensembl ID:
ENSDARG00000089532
Description:
ubiquitin protein ligase E3 component n-recognin 3 (putative) [Source:HGNC Symbol;Acc:30467]
Human Orthologue:
UBR3
Human Description:
ubiquitin protein ligase E3 component n-recognin 3 (putative) [Source:HGNC Symbol;Acc:30467]
Mouse Orthologue:
Ubr3
Mouse Description:
ubiquitin protein ligase E3 component n-recognin 3 Gene [Source:MGI Symbol;Acc:MGI:1861100]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16777 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16777
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123038 Nonsense 79 347 2 8
Genomic Location:
Chromosome 9 (position 4019469)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATGTCTGAAATGGTGCTGCCGCGGTTTATCATCACTATCATTCAATA[T/G]CTGAGAGACGGCTACACTGAACCAGGTGAGGACACCAGGGGCTTTATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/64dw7nz4