TTC28 (2 of 2)

Ensembl ID:
ENSDARG00000089527
Description:
tetratricopeptide repeat domain 28 [Source:HGNC Symbol;Acc:29179]
Human Orthologue:
TTC28
Human Description:
tetratricopeptide repeat domain 28 [Source:HGNC Symbol;Acc:29179]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18287 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130461 Essential Splice Site 59 166 3 3
Genomic Location:
Chromosome 10 (position 3892518)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTATTAATATTCTACTAATCCCTAATGTTKCTTTCATTCATTTGCCTGC[A/T]GAAWCACTAGAGCCGACCTAYCAGCAGCTGCAGAAGATGAAGCTGGACAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/crybpwu6