si:ch211-250e5.15

Ensembl ID:
ENSDARG00000089516
ZFIN ID:
ZDB-GENE-050208-512
Description:
Novel rhamnose binding lectin [Source:UniProtKB/TrEMBL;Acc:A3KGY0]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24188 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113381 Essential Splice Site 90 128 4 6
ENSDART00000136286 Essential Splice Site 98 136 4 6

The following transcripts of ENSDARG00000089516 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26293062)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25723147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGAAACACCCACTGCTATACACCAAATGCTGTCTTCATTGTGGGAAGACG[G/A]TATAATGTTTACAACTAAACAAATCAGTTTAGGCCAGTTAATCAAATGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link