ENSDARG00000089494

Ensembl ID:
ENSDARG00000089494
Human Orthologue:
RNF213
Human Description:
ring finger protein 213 [Source:HGNC Symbol;Acc:14539]
Mouse Orthologue:
Rnf213
Mouse Description:
ring finger protein 213 Gene [Source:MGI Symbol;Acc:MGI:1289196]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44412 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44412
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121423 Essential Splice Site 197 338 6 8
Genomic Location (Zv9):
Chromosome Zv9_NA510 (position 10159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTTATTGAAATGAATAAATATACAAACCACTGTTTCTCATCCCTTCA[G/T]GGAGAGACCGCAGGTTCTTGACTAAGGCCCTTTCGCCTTTTGATGACTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link