si:dkey-12j5.1

Ensembl ID:
ENSDARG00000089480
ZFIN ID:
ZDB-GENE-100922-71

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7427 Missense Mutation detected in F1 DNA During 2017
sa11309 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121671 Missense 113 289 4 8
ENSDART00000141911 Missense 235 411 7 11
Genomic Location (Zv9):
Chromosome 16 (position 30476941)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28314079
KASP Assay ID:
554-4326.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTACAGTCAGAGTAAATAGTATTTTATTATGCTTGTATGCAGGAGGGA[C/T]GTGAGTACCTGAAGAAGAGTGTGTCGTCATGGTTACCTAGCCTACARAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11309
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121671 Essential Splice Site 172 289 5 8
ENSDART00000141911 Essential Splice Site 294 411 8 11
Genomic Location (Zv9):
Chromosome 16 (position 30473759)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 28310897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAGAATAACAACAGCCAAACTGYTGATCGAGGCTGAGGAGTATGAGG[T/C]AAGACTGTWTTCTAACACTTTATAAATGCTTCAATCTGTTTCCTTTAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link