FAM161B

Ensembl ID:
ENSDARG00000089467
Description:
family with sequence similarity 161, member B [Source:HGNC Symbol;Acc:19854]
Human Orthologue:
FAM161B
Human Description:
family with sequence similarity 161, member B [Source:HGNC Symbol;Acc:19854]
Mouse Orthologue:
Fam161b
Mouse Description:
family with sequence similarity 161, member B Gene [Source:MGI Symbol;Acc:MGI:2443027]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23170 Nonsense Mutation detected in F1 DNA During 2016
sa39178 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123971 Nonsense 40 577 2 9
Genomic Location:
Chromosome 17 (position 45173512)
KASP Assay ID:
2261-1510.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTCAGAAAGCCTGCTGTCGCTTATAGAGGACAGGAAGAAGACTGAA[C/T]AATCTATGGAGTTGCATTTGGAGGCTCTGAAGGTCAAACGCAAGCAGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123971 Essential Splice Site 107 577 2 9
Genomic Location:
Chromosome 17 (position 45173309)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCAGCAGAGCATCAGCGATCATGATGGGCCGGATCGTAAACACCACAG[G/A]TAGCTCATATTGTAAATGTGACAGCAGATTTTCAAAAACATTTGCTCTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link