si:ch211-194p15.1

Ensembl ID:
ENSDARG00000089464
ZFIN ID:
ZDB-GENE-090313-67
Human Orthologue:
MYT1
Human Description:
myelin transcription factor 1 [Source:HGNC Symbol;Acc:7622]
Mouse Orthologue:
Myt1
Mouse Description:
myelin transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1100535]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14230 Nonsense Available for shipment Available now
sa37614 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14230
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123681 Nonsense 742 1142 10 20
ENSDART00000137003   None 91 None 5

The following transcripts of ENSDARG00000089464 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 7860749)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7837622
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCATGGCAACAGCAGCATCTCGCCTCATTCTTTGCACACCTATAAACAA[G/T]AGGARTGGGAGGGGCCTCTGGACTACACTAAACCCAATCGGCAGAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37614
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123681 Nonsense 988 1142 17 20
ENSDART00000137003   None 91 None 5

The following transcripts of ENSDARG00000089464 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 7855282)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7832155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTGATGATGAATCAATTGTGTTTGGCCCCAGTCTCTCCGGCTGCCCC[A/T]GAGCCTCCCTCAACAAGAAGAAAGCCAAGTTCCCTGGAGAAGAGTATCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link