ciz1

Ensembl ID:
ENSDARG00000089461
ZFIN ID:
ZDB-GENE-040426-2933
Description:
CDKN1A interacting zinc finger protein 1 [Source:RefSeq peptide;Acc:NP_998690]
Human Orthologue:
CIZ1
Human Description:
CDKN1A interacting zinc finger protein 1 [Source:HGNC Symbol;Acc:16744]
Mouse Orthologue:
Ciz1
Mouse Description:
CDKN1A interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1920234]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3541 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3541
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026067 Nonsense 193 566 8 13
ENSDART00000111403 Nonsense 232 605 8 13
Genomic Location:
Chromosome 5 (position 66925849)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGAAACAATTGTTGGTTTGTTTTGTTCTAGAGAAAGGAGGACGGGTAAT[C/T]AGCGCTGGTGTCCAACCTGCCAGTGTTATTTTACTGGTGACCTCATTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7rnmrd3f