LOC100332857

Ensembl ID:
ENSDARG00000089458
Human Orthologue:
RP1L1
Human Description:
retinitis pigmentosa 1-like 1 [Source:HGNC Symbol;Acc:15946]
Mouse Orthologue:
Rp1l1
Mouse Description:
retinitis pigmentosa 1 homolog (human)-like 1 Gene [Source:MGI Symbol;Acc:MGI:2384303]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36294 Nonsense Mutation detected in F1 DNA During 2016
sa39138 Nonsense Mutation detected in F1 DNA During 2016
sa36295 Nonsense Mutation detected in F1 DNA During 2016
sa39139 Nonsense Mutation detected in F1 DNA During 2016
sa22985 Nonsense Mutation detected in F1 DNA During 2016
sa42856 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36294
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126764 Nonsense 156 2394 1 3
Genomic Location:
Chromosome 17 (position 5562677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATAACACCCGCCGAAAGCCGTCCCGACCTGATGAACCCCTATCAGGACAC[C/T]AACACCACCATCATCGGCACCCCAAAAGGATTATTCTCGTGAAAAACAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126764 Nonsense 249 2394 2 3
Genomic Location:
Chromosome 17 (position 5573651)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGTCGAGAACCATTCAGGCCGTTGCTCGTTGAAAGCTTGAAGAAACTCT[C/A]AGATGAAAAGCTTCCTGGAGTGGGCACGAGGTCACACTCCAGCGTCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36295
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126764 Nonsense 270 2394 2 3
Genomic Location:
Chromosome 17 (position 5573713)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTGGAGTGGGCACGAGGTCACACTCCAGCGTCTGCAGTGAAGGCCAT[G/T]AAAGCAAAAAGAATGGTAAATATTTTCTCTCACTGTGCGCACAGTTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126764 Nonsense 1126 2394 3 3
Genomic Location:
Chromosome 17 (position 5579478)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGAAAGATCCATCAAATCTGAGACACAGAAAACAACACTGAATGCCT[T/G]AACTGTGACCTCACCATTGCCTAGGAAAAAGCAGTCTCCTTCTCCTAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22985
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126764 Nonsense 1705 2394 3 3
Genomic Location:
Chromosome 17 (position 5581215)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAAATTAAGCCAGTCTGCTCAAGGGCTTTTGGACTGCCTAGCAAACT[T/G]AAGATTGATTGATTCAGACTCTAAAGATGAAAAGCATCGTAAATACAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126764 Nonsense 1864 2394 3 3
Genomic Location:
Chromosome 17 (position 5581691)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAGATGTTTCAAGTTCCGAGAATAAGAATGAATCCGATCAAACGCCA[C/T]AAACGACTTCTTACAAGAGCTCTGGGAATGAGAGTTACACGATGAAATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link