ENSDARG00000089454

Ensembl ID:
ENSDARG00000089454

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36416 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127120 Nonsense 189 439 3 5
Genomic Location (Zv9):
Chromosome 17 (position 25137793)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 25329484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGTGAGGATGGACGAGCATACACCTCTCCGAAAGCGTTCTGTTGCT[G/T]GACGCTCAAAACTGCCTGTTCTGAAGTCAAGGTGTGTTCCTGTGAAACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link