CCPG1 (1 of 2)

Ensembl ID:
ENSDARG00000089453
Description:
cell cycle progression 1 [Source:HGNC Symbol;Acc:24227]
Human Orthologue:
CCPG1
Human Description:
cell cycle progression 1 [Source:HGNC Symbol;Acc:24227]
Mouse Orthologue:
Ccpg1
Mouse Description:
cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24802 Nonsense Available for shipment Available now
sa38200 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa24802
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124585 Nonsense 27 524 3 7
ENSDART00000126341 Nonsense 27 582 3 8
Genomic Location (Zv9):
Chromosome Zv9_NA603 (position 13747)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150387.1 13747
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAAACAAACGTGTGTGTGTTTCAGGCACAGTGCAGATTCAGGAGAGG[C/T]AAAGGATTGTGGAGAAGAGTCGTGTGATTGAGCTGGACGTGCCTTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38200
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124585 Nonsense 86 524 4 7
ENSDART00000126341 Nonsense 141 582 6 8
Genomic Location (Zv9):
Chromosome Zv9_NA603 (position 9921)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150387.1 9921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATCTGACCGCCGAGAACCAGAAGCTTAAAATCTCTCTTGAGCGAGAA[G/T]AAGCGTCTCTGTCGGCCCTTCAGGAGGAGCTGTTGGTCCTGCGGGGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link