OMG (2 of 2)

Ensembl ID:
ENSDARG00000089444
Description:
oligodendrocyte myelin glycoprotein [Source:HGNC Symbol;Acc:8135]
Human Orthologue:
OMG
Human Description:
oligodendrocyte myelin glycoprotein [Source:HGNC Symbol;Acc:8135]
Mouse Orthologue:
Omg
Mouse Description:
oligodendrocyte myelin glycoprotein Gene [Source:MGI Symbol;Acc:MGI:106586]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15202 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15202
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129474 Nonsense 111 395 2 2
Genomic Location:
Chromosome 15 (position 30217278)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KCACCACCTTCCTGTCGGTCTGCCAAGAGCTCTTTGGGATATACGTGCCT[C/A]AGGAAAYTACATCCGCCAACTGGAGAAGAMCRATACAGCCTACCACTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nyidr2o0