LOC100002045

Ensembl ID:
ENSDARG00000089439
Human Orthologues:
TMEM132A, TMEM132B, TMEM132C, TMEM132D, TMEM132E
Human Descriptions:
transmembrane protein 132A [Source:HGNC Symbol;Acc:31092]
transmembrane protein 132B [Source:HGNC Symbol;Acc:29397]
transmembrane protein 132C [Source:HGNC Symbol;Acc:25436]
transmembrane protein 132D [Source:HGNC Symbol;Acc:29411]
transmembrane protein 132E [Source:HGNC Symbol;Acc:26991]
Mouse Orthologues:
Tmem132a, Tmem132b, Tmem132b, Tmem132c, Tmem132d, Tmem132e
Mouse Descriptions:
transmembrane protein 132A Gene [Source:MGI Symbol;Acc:MGI:2147810]
transmembrane protein 132B Gene [Source:MGI Symbol;Acc:MGI:3609245]
transmembrane protein 132B Gene [Source:MGI Symbol;Acc:MGI:3609245]
transmembrane protein 132C Gene [Source:MGI Symbol;Acc:MGI:2443061]
transmembrane protein 132D Gene [Source:MGI Symbol;Acc:MGI:3044963]
transmembrane protein 132E Gene [Source:MGI Symbol;Acc:MGI:2685490]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39669 Nonsense Mutation detected in F1 DNA During 2016
sa19551 Nonsense Mutation detected in F1 DNA During 2016
sa32736 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39669
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126296 Nonsense 229 971 4 11
Genomic Location:
Chromosome 1 (position 45445176)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGAGAAGGCATCCGCATATGCCAGCAGGACACAGGGCCCGGCCTGAT[C/T]AAATTCAGCTTTACTACTCATCCTTTGGCATCCTGTCCATTAAAACCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126296 Nonsense 748 971 11 11
Genomic Location:
Chromosome 1 (position 45452132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTCCTCTTTGGCAGAATCTGTGGTTGCAGTAACGCCTGCTCCATCC[C/T]AACGCATTTTGGCACAAGGTGATGGCGGAGGACCTCTTGTTAAAGCCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126296 Nonsense 946 971 11 11
Genomic Location:
Chromosome 1 (position 45452726)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGACGAGAGGGAAATGTGAAAGACACTGTGGAGGAGGAACCTGGAGAA[G/T]AGCAAGAGGAGAATAGACAAGAGGAAAAACAGTGCAGAGCAGTGATAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link