LOC100002045

Ensembl ID:
ENSDARG00000089439
Human Orthologues:
TMEM132A, TMEM132B, TMEM132C, TMEM132D, TMEM132E
Human Descriptions:
transmembrane protein 132A [Source:HGNC Symbol;Acc:31092]
transmembrane protein 132B [Source:HGNC Symbol;Acc:29397]
transmembrane protein 132C [Source:HGNC Symbol;Acc:25436]
transmembrane protein 132D [Source:HGNC Symbol;Acc:29411]
transmembrane protein 132E [Source:HGNC Symbol;Acc:26991]
Mouse Orthologues:
Tmem132a, Tmem132b, Tmem132b, Tmem132c, Tmem132d, Tmem132e
Mouse Descriptions:
transmembrane protein 132A Gene [Source:MGI Symbol;Acc:MGI:2147810]
transmembrane protein 132B Gene [Source:MGI Symbol;Acc:MGI:3609245]
transmembrane protein 132B Gene [Source:MGI Symbol;Acc:MGI:3609245]
transmembrane protein 132C Gene [Source:MGI Symbol;Acc:MGI:2443061]
transmembrane protein 132D Gene [Source:MGI Symbol;Acc:MGI:3044963]
transmembrane protein 132E Gene [Source:MGI Symbol;Acc:MGI:2685490]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19551 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126296 Nonsense 748 971 11 11
Genomic Location:
Chromosome 1 (position 45452132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTCCTCTTTGGCAGAATCTGTGGTTGCAGTAACGCCTGCTCCATCC[C/T]AACGCATTTTGGCACAAGGTGATGGCGGAGGACCTCTTGTTAAAGCCGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/krexhkiz