NAV1 (3 of 3)

Ensembl ID:
ENSDARG00000089438
Description:
neuron navigator 1 [Source:HGNC Symbol;Acc:15989]
Human Orthologue:
NAV1
Human Description:
neuron navigator 1 [Source:HGNC Symbol;Acc:15989]
Mouse Orthologue:
Nav1
Mouse Description:
neuron navigator 1 Gene [Source:MGI Symbol;Acc:MGI:2183683]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8611 Nonsense Mutation detected in F1 DNA During 2017
sa10347 Nonsense Available for shipment Available now
sa9298 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8611
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122130 Nonsense 63 649 1 6
Genomic Location (Zv9):
Chromosome 6 (position 54862380)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54879209
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCYGTCCTGACGGATGCTGAGAAGAAGATGCAGCTCTATGAGCCCAAGT[G/A]GTGYGATGACATGAGYAAAGCTGCTTCAGGACACCTGAAGAAGCCTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122130 Nonsense 125 649 1 6
ENSDART00000122130 Nonsense 125 649 1 6
Genomic Location (Zv9):
Chromosome 6 (position 54862565)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54879394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCATTCACCCCACTTGCAGCACCGGGAAAAGGCCAAAGTCGGATCCCT[C/T]GAGGCCCCTACGCGGAAGTAAAACCCTTGAGCAAGACAWCYGATGACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122130 Nonsense 125 649 1 6
ENSDART00000122130 Nonsense 125 649 1 6
Genomic Location (Zv9):
Chromosome 6 (position 54862565)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54879394
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGCATTCACCCCACTTGCAGCACCGGGAAAAGGCCAAAGTCGGATCCCT[C/T]GAGGCCCCTACGCGGAAGTAAAACCCTTGAGCAAGACAWCYGATGACTGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link