ENSDARG00000089436

Ensembl ID:
ENSDARG00000089436

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38215 Nonsense Available for shipment Available now
sa24783 Nonsense Available for shipment Available now
sa32564 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38215
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129746 Nonsense 382 1170 2 9
Genomic Location (Zv9):
Chromosome Zv9_NA787 (position 71428)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150605.1 71428
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAATTCAGGAGTCTGTACATCATGTGCCACATCCCCGTCTTCTGCTG[G/A]ATTTCTCTCACTGTTCTTCAGCCTCTGCTGGGTCAAGAGAGCAATGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24783
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129746 Nonsense 818 1170 5 9
Genomic Location (Zv9):
Chromosome Zv9_NA787 (position 75139)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150605.1 75139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCTTCTTTCTCAAGACTGGTCATGTGTAATGTCACCGCTCAGCATTG[T/A]GAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTTCTGAGAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32564
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129746 Nonsense 843 1170 5 9
Genomic Location (Zv9):
Chromosome Zv9_NA787 (position 75212)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150605.1 75212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTCAAACTGTGTTCTGAGAGAGCTGGACCTGAGTAACAATGACCTG[C/T]AGGATTCAGGAGTGAAGCTTCTCTCTGCTGGACTGAAGAGTCAACACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link