ENSDARG00000089436

Ensembl ID:
ENSDARG00000089436

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38215 Nonsense Mutation detected in F1 DNA During 2016
sa24783 Nonsense Mutation detected in F1 DNA During 2016
sa32564 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129746 Nonsense 382 1170 2 9
Genomic Location:
Chromosome Zv9_NA787 (position 71428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAAATTCAGGAGTCTGTACATCATGTGCCACATCCCCGTCTTCTGCTG[G/A]ATTTCTCTCACTGTTCTTCAGCCTCTGCTGGGTCAAGAGAGCAATGAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129746 Nonsense 818 1170 5 9
Genomic Location:
Chromosome Zv9_NA787 (position 75139)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCTTCTTTCTCAAGACTGGTCATGTGTAATGTCACCGCTCAGCATTG[T/A]GAGAGTTTGTCTTCAGCTCTACAATCCTCAAACTGTGTTCTGAGAGAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32564
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129746 Nonsense 843 1170 5 9
Genomic Location:
Chromosome Zv9_NA787 (position 75212)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTCAAACTGTGTTCTGAGAGAGCTGGACCTGAGTAACAATGACCTG[C/T]AGGATTCAGGAGTGAAGCTTCTCTCTGCTGGACTGAAGAGTCAACACTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link